StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

How does DNA relate to you - Essay Example

Cite this document
Summary
All the information on an individual’s body cells is contained in the DNA, which is a twisted band of strings consisting of the…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER93.7% of users find it useful
How does DNA relate to you
Read Text Preview

Extract of sample "How does DNA relate to you"

Recent studies show that DNA directly relates to an individual in regard to the exercises that an individual participates in and the degree of aging.All the information on an individual’s body cells is contained in the DNA, which is a twisted band of strings consisting of the individual genes that create cells. At the end of these strands, there exist telomeres that prevent the unraveling of chromosomes (News Medical, 2012). In addition, the wellbeing of an individual is contained in these strands of chromosomes and the caps at the end, telomeres.

This is because, the telomeres; as a result of preventing fraying, they also prevent aging and the development of malignant tumors that threaten appropriate health (The Philadelphia Inquirer and The Washington Post, 2008).Moreover, through participating in exercise, the telomeres experience extended life by making them appear younger and thus staying in place. This leaves an individual healthy showing the direct relationship between an individual and the DNA in them. In addition, DNA is unique in everyone, which, in turn, makes every person unlike the other who follows mutation during replications.

These mutations occur during terms of misprints and entire changes in replicated DNA. Therefore, this information indicates that only DNA of identical twins is similar (Port, 2008).In terms of survival, for one to live in adverse conditions, genes contained in the DNA effect changes (Designed DNA, 2012). These changes lead to evolutions and adaptations that allow an individual to cope in adverse conditions. In addition, changes could be physical in the form of shape of the teeth or hair color and even the behavior of an individual so as to escape danger (San Diego University of Man, 2001).

In conclusion, the relation between an individual and DNA cannot be refuted as it is the DNA that accounts for the unique characteristics they possess. ReferencesDesign DNA. ( 2012). Mechanisms of Adaptation in Biology- Genetic Diversity. Retrieved on 2nd July from http://designed-dna.org/blog/files/7b7c319a627ac85d75cf1616908b9eb0-5.phpNews Medical. (2012). Telomere- What are Telomeres? Retrieved on 2nd July 2012 from http://www.news-medical.net/health/Telomere-What-are-Telomeres.aspxPort Tami. (2008). What Is a Genetic DNA Mutation?

Retrieved on 2nd July 2012 from http://suite101.com/article/what-is-a-genetic-dna-mutation-a51959San Diego University of Man. (2001). Footsteps Through Time; $ Million Years of Human Evolution. Retrieved on 2nd July 2012 from http://abouthumanevolution.org/html/site/intro.htmThe Philadelphia Inquirer and The Washington Post. (January 29, 2008). Exercise linked to “Younger” DNA. The Seattle Times. Retrieved on 2nd July from http://seattletimes.nwsource.com/html/nationworld/2004150728_exercise29.html

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“How does DNA relate to you Essay Example | Topics and Well Written Essays - 250 words”, n.d.)
Retrieved from https://studentshare.org/anthropology/1599619-how-does-dna-relate-to-you
(How Does DNA Relate to You Essay Example | Topics and Well Written Essays - 250 Words)
https://studentshare.org/anthropology/1599619-how-does-dna-relate-to-you.
“How Does DNA Relate to You Essay Example | Topics and Well Written Essays - 250 Words”, n.d. https://studentshare.org/anthropology/1599619-how-does-dna-relate-to-you.
  • Cited: 0 times

CHECK THESE SAMPLES OF How does DNA relate to you

Practical Issues in Bioinformatics

From the BLAST output what can you say about the distribution of the gene amongst different species?... 2) Using the secondary databases find out as much as you can about the functional and structural properties of the gene.... Subject: Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database Coursework Date: 26th October 2012 Partial dna sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene....
6 Pages (1500 words) Assignment

How Would the Mutation Affect the Coding Sequence of the Gene

Can you deduce anything from these data Check that your sequences are appropriately gapped .... Can you deduce anything from these data Representative Sequence Length Mass (Da) A2QKA5 Checksum: FF7C4CB42EEB5629385 41,846 10 20... Less favorable (or deleterious) mutations can be reduced in frequency in the gene pool by natural selection, while more favorable (beneficial or advantageous) mutations may accumulate and result in adaptive evolutionary changes. … Mutation is generally accepted by the scientific community as the mechanism upon which natural selection acts, providing the advantageous new traits that survive and multiply in offspring or disadvantageous traits that die out with weaker organisms. Changes in dna caused by mutation can cause errors in protein sequence, creating partially or completely non-functional proteins....
6 Pages (1500 words) Essay

Spray Tanning Issues

The bronzer is water-soluble and will wash off but does not affect the overall tan.... (Tillson, 2008)A consultant can guide how to protect nasal passages and mouth from breathing in the mist.... More than 1 million populations of America go to tanning salons to get tan in one day....
4 Pages (1000 words) Essay

Does Watching TV Make You Smarter

Dana Stevens's essay “Does watching TV make you smarter?... Does watching TV make you smarter?... ana Stevens's essay “Does watching TV make you smarter?... Stevens observes that the best way to counter Johnson's argument would be to reverse the equally baseless view by ant-TV crowd – just turn off TV till Sunday and see if you get any dumber.... However, Stevens does not adhere to the wet-blank Puritanism of the anti-TV crowd which assumes that a week with no TV will make people smarter....
2 Pages (500 words) Book Report/Review

When Does Life Begin

Science explores realism it looks for realistic and indubitable truths; accuracy is steady, and thus each piece of scientific know-how fits into one of two classifications: either it assists to clarify the truth, or it is in inaccuracy and thus it is technically defective and will in due course be invalidated....
11 Pages (2750 words) Research Paper

Cell Walls and Plasma Membranes

Moreover, as the structure always relate to the function, the presence of double membrane, i.... Mitochondria have circular dna which replicates similar to bacteria by a reproductive process called fission, they can make their own proteins.... Cell wall and plasma membrane are primary examples because they protect the contents of the cell from the external environment as well as harmful foreign bodies. A nucleus is the brain… Similarly, the nucleoid region in the bacteria also tends to be located towards the center....
4 Pages (1000 words) Essay

The Pros and Cons of DNA Testing in Law Enforcement

This paper argues that although dna testing is extremely useful to law enforcement it has potential pitfalls too.... When looking at different criminological theories, anyone who intends to make a future in this profession will have to come to terms with the pros and cons of dna testing.... So it is with law enforcement and technologies like dna profiling, dna databases, and biometrics.... The techniques, especially dna testing, are now an integral part of efforts to prevent and solve crimes—largely because of their success rate and their level of convenience....
8 Pages (2000 words) Term Paper

Ted Talk: 5 Discussions

rdquo; It is possible to locate where you're messaging or posting from, they can see where you eat, what you drive, where and how often you work, and who your friends and relatives are.... When someone decides to become a teacher they have to go to school and learn an immense number of, what he defines as, outdated education theories, as to how to relate, engage, and lead a successful class Emdin explains that it really does not matter how many degrees you have if the students are not listening and it does not matter what approaches you use if you ascribe to rigid unappealing and formal tones and attitudes....
7 Pages (1750 words) Assignment
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us